Jörg Piringer is an author and performer of digitally enhanced sound performances and digital visual poetry. Reflecting how we use language every day in a technical environment Jörg decided early on that the very instruments that shape our language experience need attention. Jörg’s instruments are the digital algorithms and data bases of myriads of language fragments alongside his self-produced soft- and hardware.
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA
This is a genetic code. This is also a readymade poem and originally an excerpt of the human genome code of chromosome one which Jörg turned into a sound poem. What fascinates me about Jörg’s work is the dedication to technical means as that which determines how we perceive language today, language turned into a repeatable code of strata of elements. That is literature that surpasses our general notion of what literature could be. Linguistically informed, Jörg’s literature is the invisible language-mechanical noise that surrounds us every day in the invisible algorithms of our gadgets and computers.
First a writer, then a programmer
In the 90ties there was much fuzz about that thing which could connect the world via data streams, that was the internet, o-tone: “A whole new world of exiting possibilities”. AOL for example had the famous tennis player Boris Becker advertise in Germany for their internet service with the flippantly slogan: “Erh? I am in or what?! Ah yes, I am in (smiling)” which humoristic effects nobody can deny. At that time, the personal computer was already part of every day experience. But anyways it was the times when the digital revolution started off.
Austria in the 90ties. When Jörg set off as a writer he quickly came to a point of severe doubt about his profession in that very same decade. What can a writer do nowadays facing the progressing world and the coming digital revolution? What options are there for a writer to explore?
And over the time the questions did not stop but have intensified. Language has piled up. How does it feel like to be living in these times with artificial language and great resources of archived word material which is accessible so easily? And today in the times of big companies like google or facebook and big data there arises the question and curiosity of how exactly this world works – in terms of language.
A literate programmer. Quantity over quality
Jörg’s corpus of work is huge. By now Jörg has made numerous sound pieces and works that derive from digital procession of language. Evaluation of databases, partly from the one Jörg is himself working on, transformed and presented by a computer generated voice.
Or there are videos that seek to inform about statistical uses of language.
Or Coded poetry (mainly again put into sound).
In the last few years Jörg has turned to performances (because of the money he tells me).
At the moment Jörg is working on an album that is called “dark voice”. The tracks are based on an self-invented artificial language that is put into music. Based on the concept of coded language used for American military communication systems it critizes surveillance fostered through the internet and executed by multinational companies and the US government. During second world war the American army used the language of the Navajos to communicate without someone being able to hack the code. By being a very unique language nobody was able to understand because there existed no dictionary for that language it was the best thinkable way to have a unique code. Jörg will though set this as an example into practice resulting in an album called “darkvoice” with a text story – that is yet to be released.
Photo: Screenshot from frikativ (excerpt), 23.12.2015. Copyright: Jörg Piringer